Transcript: Mouse NM_016659.3

Mus musculus killer cell lectin-like receptor, subfamily A, member 1 (Klra1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Klra1 (16627)
Length:
1667
CDS:
577..1365

Additional Resources:

NCBI RefSeq record:
NM_016659.3
NBCI Gene record:
Klra1 (16627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068061 GTGGGAAGAGACTGGATAAAT pLKO.1 1334 CDS 100% 15.000 9.000 N Klra1 n/a
2 TRCN0000068058 CCTGCCAGAGTTCCAGTTTAT pLKO.1 1073 CDS 100% 13.200 7.920 N Klra1 n/a
3 TRCN0000068062 GTGAGACCTGAGGAGACTAAA pLKO.1 643 CDS 100% 13.200 6.600 Y Klra1 n/a
4 TRCN0000065558 GCTGTTTCAGTGTTGGCAATA pLKO.1 754 CDS 100% 10.800 5.400 Y Klra15 n/a
5 TRCN0000065562 CCACAATAACTGCAGCAACAT pLKO.1 825 CDS 100% 4.950 2.475 Y Klra15 n/a
6 TRCN0000065559 CCACTGGAAGTTCATTGTGAT pLKO.1 699 CDS 100% 4.950 2.475 Y Klra15 n/a
7 TRCN0000065459 CCCATCTAAACTTGCCTTGAA pLKO.1 1218 CDS 100% 4.950 2.475 Y Klra4 n/a
8 TRCN0000065755 GACATCAACTTGAAGGATGAA pLKO.1 853 CDS 100% 4.950 2.475 Y Klra12 n/a
9 TRCN0000065647 GACTGGATAAATTCCCTCATT pLKO.1 1343 CDS 100% 4.950 2.475 Y Klra7 n/a
10 TRCN0000065462 GCAAAGTGACATCAACTTGAA pLKO.1 846 CDS 100% 4.950 2.475 Y Klra4 n/a
11 TRCN0000067966 TCTGTATTTGTGGGAAGAGAT pLKO.1 1325 CDS 100% 4.950 2.475 Y Klra18 n/a
12 TRCN0000174124 TCTGTATTTGTGGGAAGAGAT pLKO.1 1325 CDS 100% 4.950 2.475 Y Klra18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.