Transcript: Mouse NM_016688.2

Mus musculus programmed cell death 7 (Pdcd7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pdcd7 (50996)
Length:
2471
CDS:
75..1529

Additional Resources:

NCBI RefSeq record:
NM_016688.2
NBCI Gene record:
Pdcd7 (50996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246595 ACGGCCATTCAGCTGCATTAA pLKO_005 1509 CDS 100% 13.200 18.480 N Pdcd7 n/a
2 TRCN0000246596 TGCAGCCATTCCGGCAGTATT pLKO_005 1342 CDS 100% 13.200 18.480 N Pdcd7 n/a
3 TRCN0000157384 GATCCAGATGAGTTCCCACTT pLKO.1 1311 CDS 100% 4.050 5.670 N PDCD7 n/a
4 TRCN0000173504 GAAACGGGAAATTGAGTCCAA pLKO.1 1280 CDS 100% 2.640 3.696 N Pdcd7 n/a
5 TRCN0000216001 CTAGATGAACTGAGGTTATTA pLKO.1 1728 3UTR 100% 15.000 12.000 N Pdcd7 n/a
6 TRCN0000246594 CTAGATGAACTGAGGTTATTA pLKO_005 1728 3UTR 100% 15.000 12.000 N Pdcd7 n/a
7 TRCN0000246598 AGCGGCTGAGAAAGCTCATTA pLKO_005 1129 CDS 100% 13.200 9.240 N Pdcd7 n/a
8 TRCN0000246597 CTACTACAGAAACGGGAAATT pLKO_005 1272 CDS 100% 13.200 9.240 N Pdcd7 n/a
9 TRCN0000174796 GAGAAAGAGAAACTTCTACTA pLKO.1 1257 CDS 100% 4.950 3.465 N Pdcd7 n/a
10 TRCN0000437781 AGCAACGACATCTGGGCAACT pLKO_005 1491 CDS 100% 4.050 2.835 N PDCD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.