Transcript: Mouse NM_016704.2

Mus musculus complement component 6 (C6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
C6 (12274)
Length:
2863
CDS:
129..2438

Additional Resources:

NCBI RefSeq record:
NM_016704.2
NBCI Gene record:
C6 (12274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067172 GCCTTCAACAAAGTCATTAAA pLKO.1 1020 CDS 100% 15.000 10.500 N C6 n/a
2 TRCN0000067170 CCAGTAATCCATACCGTGTTT pLKO.1 805 CDS 100% 4.950 3.465 N C6 n/a
3 TRCN0000067169 CCATGTATCAATGATGATGAA pLKO.1 1992 CDS 100% 4.950 3.465 N C6 n/a
4 TRCN0000067168 CCCAGCAAGTTAGAATGCAAT pLKO.1 585 CDS 100% 4.950 3.465 N C6 n/a
5 TRCN0000067171 GCTTTGTTGTTGCTGGACCAT pLKO.1 2332 CDS 100% 2.640 1.848 N C6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.