Transcript: Mouse NM_016742.4

Mus musculus cell division cycle 37 (Cdc37), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cdc37 (12539)
Length:
2456
CDS:
50..1189

Additional Resources:

NCBI RefSeq record:
NM_016742.4
NBCI Gene record:
Cdc37 (12539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087820 GATCCCACTGATGCCAAGTAT pLKO.1 1025 CDS 100% 5.625 4.500 N Cdc37 n/a
2 TRCN0000315590 GATCCCACTGATGCCAAGTAT pLKO_005 1025 CDS 100% 5.625 4.500 N Cdc37 n/a
3 TRCN0000087819 CTGGGATGACAGCCAGAAATA pLKO.1 553 CDS 100% 13.200 9.240 N Cdc37 n/a
4 TRCN0000315516 CTGGGATGACAGCCAGAAATA pLKO_005 553 CDS 100% 13.200 9.240 N Cdc37 n/a
5 TRCN0000087821 CAGAAACACAAGACCTTCGTT pLKO.1 488 CDS 100% 3.000 2.100 N Cdc37 n/a
6 TRCN0000315515 CAGAAACACAAGACCTTCGTT pLKO_005 488 CDS 100% 3.000 2.100 N Cdc37 n/a
7 TRCN0000087822 GAGAAGGCCATGAAGGAATAT pLKO.1 866 CDS 100% 13.200 7.920 N Cdc37 n/a
8 TRCN0000309108 GAGAAGGCCATGAAGGAATAT pLKO_005 866 CDS 100% 13.200 7.920 N Cdc37 n/a
9 TRCN0000087818 GCTGGCCTCAAACTCAGATAT pLKO.1 1956 3UTR 100% 13.200 6.600 Y Cdc37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.