Transcript: Mouse NM_016868.3

Mus musculus hypoxia inducible factor 3, alpha subunit (Hif3a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hif3a (53417)
Length:
6947
CDS:
84..2072

Additional Resources:

NCBI RefSeq record:
NM_016868.3
NBCI Gene record:
Hif3a (53417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229465 CAGGCCGAACCTGTCAAAGAA pLKO_005 518 CDS 100% 5.625 7.875 N LOC641092 n/a
2 TRCN0000084949 CTATGAATACATCCACGCTTT pLKO.1 899 CDS 100% 4.050 5.670 N Hif3a n/a
3 TRCN0000229467 GCTGCACTGCTCAGGACATAT pLKO_005 641 CDS 100% 13.200 9.240 N LOC641092 n/a
4 TRCN0000435348 TAGACAACTGTAATCACATTT pLKO_005 2435 3UTR 100% 13.200 9.240 N Hif3a n/a
5 TRCN0000417156 GCTCAACTCCAGCGAGCAATT pLKO_005 1571 CDS 100% 10.800 7.560 N Hif3a n/a
6 TRCN0000412360 TCAGTCAGCTGGAGCTCATTG pLKO_005 433 CDS 100% 10.800 7.560 N Hif3a n/a
7 TRCN0000218834 TCATTGGACACAGTATCTTTG pLKO_005 448 CDS 100% 10.800 7.560 N LOC641092 n/a
8 TRCN0000229464 TGTGACCAAGAGGAACTTCAA pLKO_005 483 CDS 100% 4.950 3.465 N LOC641092 n/a
9 TRCN0000084952 ACATGGCTTACCTGTCGGAAA pLKO.1 391 CDS 100% 4.050 2.835 N Hif3a n/a
10 TRCN0000429212 TGCGACGAGAGGATTGCAGAA pLKO_005 837 CDS 100% 4.050 2.835 N Hif3a n/a
11 TRCN0000229466 TGCGAATGAAGAGCACGCTCA pLKO_005 574 CDS 100% 2.160 1.512 N LOC641092 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.