Transcript: Mouse NM_016885.2

Mus musculus endomucin (Emcn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Emcn (59308)
Length:
1437
CDS:
163..909

Additional Resources:

NCBI RefSeq record:
NM_016885.2
NBCI Gene record:
Emcn (59308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194054 GTCCGATAAAGAGAGTGTGAA pLKO.1 819 CDS 100% 4.950 6.930 N Emcn n/a
2 TRCN0000175394 CCCTCCTATTCCAGTATCATT pLKO.1 679 CDS 100% 5.625 4.500 N Emcn n/a
3 TRCN0000174719 GCTTCATCTTCAGCTTCTAAA pLKO.1 949 3UTR 100% 13.200 9.240 N Emcn n/a
4 TRCN0000174797 GAATGAAAGTTCCACTATGAA pLKO.1 462 CDS 100% 5.625 3.938 N Emcn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.