Transcript: Mouse NM_016970.1

Mus musculus killer cell lectin-like receptor subfamily G, member 1 (Klrg1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Klrg1 (50928)
Length:
1374
CDS:
23..589

Additional Resources:

NCBI RefSeq record:
NM_016970.1
NBCI Gene record:
Klrg1 (50928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417645 GGGCAAATGAAATGGATAAAG pLKO_005 814 3UTR 100% 13.200 10.560 N Klrg1 n/a
2 TRCN0000437960 TGCGGTGCCATTCACAGAAAT pLKO_005 506 CDS 100% 13.200 9.240 N Klrg1 n/a
3 TRCN0000426100 ATCTGTAAGAAGGTCCTATAC pLKO_005 566 CDS 100% 10.800 7.560 N Klrg1 n/a
4 TRCN0000066157 CGCTCAGCTTGAGGATTCTTA pLKO.1 465 CDS 100% 5.625 3.938 N Klrg1 n/a
5 TRCN0000066155 GAGGAATGGTAGCCACTGTTA pLKO.1 262 CDS 100% 4.950 3.465 N Klrg1 n/a
6 TRCN0000066156 TGGAAGCTCAAAGCTGTCTTA pLKO.1 92 CDS 100% 4.950 3.465 N Klrg1 n/a
7 TRCN0000066154 CCTCCAGTTGTGAAGTTGCTT pLKO.1 537 CDS 100% 3.000 2.100 N Klrg1 n/a
8 TRCN0000066153 GCATTCAGTAACACGTTCCAT pLKO.1 954 3UTR 100% 3.000 2.100 N Klrg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.