Transcript: Mouse NM_017378.2

Mus musculus protocadherin 12 (Pcdh12), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Pcdh12 (53601)
Length:
5587
CDS:
332..3874

Additional Resources:

NCBI RefSeq record:
NM_017378.2
NBCI Gene record:
Pcdh12 (53601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094253 CACGGGTCCTAACAGCTTATA pLKO.1 820 CDS 100% 13.200 18.480 N Pcdh12 n/a
2 TRCN0000094249 CCCGTTTCTCACTTAGTCATT pLKO.1 1838 CDS 100% 4.950 6.930 N Pcdh12 n/a
3 TRCN0000094252 CAGCGGAATTTCAATGGCAAA pLKO.1 3068 CDS 100% 4.050 5.670 N Pcdh12 n/a
4 TRCN0000094250 CGGGTCCTAACAGCTTATATT pLKO.1 822 CDS 100% 15.000 12.000 N Pcdh12 n/a
5 TRCN0000053916 CCTCTTGGATGCCAATGATAA pLKO.1 1993 CDS 100% 13.200 9.240 N PCDH12 n/a
6 TRCN0000094251 CCACCGAGGAAATAAATACTT pLKO.1 3268 CDS 100% 5.625 3.938 N Pcdh12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.