Transcript: Mouse NM_017389.2

Mus musculus eosinophil-associated, ribonuclease A family, member 14 (Ear14), mRNA.

Source:
NCBI, updated 2013-01-20
Taxon:
Mus musculus (mouse)
Gene:
Ear14 (503847)
Length:
462
CDS:
1..462

Additional Resources:

NCBI RefSeq record:
NM_017389.2
NBCI Gene record:
Ear14 (503847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255776 TACACCGAGTATATCTATAAT pLKO_005 97 CDS 100% 15.000 10.500 N Ear14 n/a
2 TRCN0000255778 CCAAGATGTAAGGACATAAAT pLKO_005 169 CDS 100% 15.000 7.500 Y Ear14 n/a
3 TRCN0000255775 TGCTGTAATGAGGGTTGTTAA pLKO_005 138 CDS 100% 13.200 6.600 Y Ear14 n/a
4 TRCN0000255777 GCTGTGTGTGGCCATCCAAAT pLKO_005 223 CDS 100% 10.800 5.400 Y Ear14 n/a
5 TRCN0000119513 TGCTAGTTCATTTCAGGTATT pLKO.1 279 CDS 100% 10.800 5.400 Y Ear4 n/a
6 TRCN0000119514 GATGCTGTAATGAGGGTTGTT pLKO.1 136 CDS 100% 4.950 2.475 Y Ear4 n/a
7 TRCN0000119516 GCCATCCAAATATCACCTGCA pLKO.1 233 CDS 100% 2.160 1.080 Y Ear4 n/a
8 TRCN0000255774 CTAGTTCATTTCAGGTATTTA pLKO_005 281 CDS 100% 0.000 0.000 Y Ear14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.