Transcript: Mouse NM_017391.3

Mus musculus solute carrier family 5 (inositol transporters), member 3 (Slc5a3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc5a3 (53881)
Length:
10918
CDS:
497..2653

Additional Resources:

NCBI RefSeq record:
NM_017391.3
NBCI Gene record:
Slc5a3 (53881)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328431 GTACGTGGCTACGGCATTATT pLKO_005 2032 CDS 100% 15.000 21.000 N Slc5a3 n/a
2 TRCN0000256898 CCTCGATGTGTACAAACTTAT pLKO_005 1669 CDS 100% 13.200 18.480 N SLC5A3 n/a
3 TRCN0000042908 GCCATAGGATTCAGGTCTATT pLKO.1 852 CDS 100% 13.200 18.480 N SLC5A3 n/a
4 TRCN0000328430 GCGCTCACACTTATGGTTATT pLKO_005 1082 CDS 100% 13.200 18.480 N Slc5a3 n/a
5 TRCN0000070091 CCATACTATTCCCAACGGGAA pLKO.1 2245 CDS 100% 2.160 3.024 N Slc5a3 n/a
6 TRCN0000070090 CCTCCCACAAAGGATCAGATT pLKO.1 2099 CDS 100% 4.950 3.960 N Slc5a3 n/a
7 TRCN0000328432 AGTAAGGAGAGACCAATTATT pLKO_005 2894 3UTR 100% 15.000 10.500 N Slc5a3 n/a
8 TRCN0000353357 ATAGCATGGGTGCCAATTATT pLKO_005 1763 CDS 100% 15.000 10.500 N Slc5a3 n/a
9 TRCN0000070088 CGCTCACACTTATGGTTATTA pLKO.1 1083 CDS 100% 15.000 10.500 N Slc5a3 n/a
10 TRCN0000328433 TGCAACCTGAAGACGTTAATC pLKO_005 2289 CDS 100% 13.200 9.240 N Slc5a3 n/a
11 TRCN0000042911 CCTCTCTGTTTGTGAGCAATA pLKO.1 654 CDS 100% 10.800 7.560 N SLC5A3 n/a
12 TRCN0000070092 CCAGTAGATGCTTATTCCAAT pLKO.1 2375 CDS 100% 4.950 3.465 N Slc5a3 n/a
13 TRCN0000070089 CCTGGATTCATTCTTGGGCAA pLKO.1 1280 CDS 100% 2.160 1.512 N Slc5a3 n/a
14 TRCN0000042912 GCTTCATCAAAGACATCCATT pLKO.1 2007 CDS 100% 4.950 2.970 N SLC5A3 n/a
15 TRCN0000042909 GCAGCTCTGATGAGTGACTTA pLKO.1 1613 CDS 100% 4.950 3.465 N SLC5A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.