Transcript: Mouse NM_017473.4

Mus musculus retinol dehydrogenase 7 (Rdh7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rdh7 (54150)
Length:
1598
CDS:
93..1043

Additional Resources:

NCBI RefSeq record:
NM_017473.4
NBCI Gene record:
Rdh7 (54150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042083 GCTATCACACAGCATAGAGAA pLKO.1 743 CDS 100% 4.950 6.930 N Rdh7 n/a
2 TRCN0000042084 CAGGACTAATGTCTCCAACTA pLKO.1 716 CDS 100% 4.950 3.960 N Rdh7 n/a
3 TRCN0000042087 CTTCCTGGTAGATGCCATGTT pLKO.1 986 CDS 100% 4.950 3.465 N Rdh7 n/a
4 TRCN0000042085 GCTATCAATGAGTGGCTGAAA pLKO.1 447 CDS 100% 4.950 3.465 N Rdh7 n/a
5 TRCN0000042086 CCTATATCAAAGCAATACAGT pLKO.1 823 CDS 100% 3.000 2.100 N Rdh7 n/a
6 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 296 CDS 100% 3.000 1.500 Y Rdh18-ps n/a
7 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 302 CDS 100% 0.660 0.330 Y Rdh18-ps n/a
8 TRCN0000041439 CCAAGACAAGTATGTCTTCAT pLKO.1 173 CDS 100% 0.495 0.248 Y Rdh19 n/a
9 TRCN0000041947 GTGAGCCATCTCCAAGACAAA pLKO.1 162 CDS 100% 4.950 2.475 Y Rdh16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.