Transcript: Human NM_017554.3

Homo sapiens poly(ADP-ribose) polymerase family member 14 (PARP14), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PARP14 (54625)
Length:
7694
CDS:
46..5451

Additional Resources:

NCBI RefSeq record:
NM_017554.3
NBCI Gene record:
PARP14 (54625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017554.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296691 CGAGGTGTGTGTACCTATTAA pLKO_005 2717 CDS 100% 15.000 21.000 N PARP14 n/a
2 TRCN0000296754 GATTGAGTTTGATACACTTAA pLKO_005 1314 CDS 100% 13.200 18.480 N PARP14 n/a
3 TRCN0000053161 CGCATTGAAGTTGAGAACAAA pLKO.1 1843 CDS 100% 5.625 4.500 N PARP14 n/a
4 TRCN0000053160 GCCATAATTGATGCCATTGAA pLKO.1 4081 CDS 100% 5.625 3.938 N PARP14 n/a
5 TRCN0000053158 CGGAACTTCATTCTTCACAAA pLKO.1 6080 3UTR 100% 4.950 3.465 N PARP14 n/a
6 TRCN0000290828 CGGAACTTCATTCTTCACAAA pLKO_005 6080 3UTR 100% 4.950 3.465 N PARP14 n/a
7 TRCN0000053162 GCACCATTTGAAGAGTCACTA pLKO.1 1003 CDS 100% 4.950 3.465 N PARP14 n/a
8 TRCN0000290897 GCACCATTTGAAGAGTCACTA pLKO_005 1003 CDS 100% 4.950 3.465 N PARP14 n/a
9 TRCN0000053159 GCAGATTGTATCAGTGAGTTT pLKO.1 4627 CDS 100% 4.950 3.465 N PARP14 n/a
10 TRCN0000296755 CATACCCAGAGTACCTTATTA pLKO_005 5417 CDS 100% 15.000 9.000 N PARP14 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 6381 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017554.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.