Transcript: Human NM_017570.5

Homo sapiens 5-oxoprolinase, ATP-hydrolysing (OPLAH), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OPLAH (26873)
Length:
4020
CDS:
94..3960

Additional Resources:

NCBI RefSeq record:
NM_017570.5
NBCI Gene record:
OPLAH (26873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017570.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050763 GCCGTCTTTCTGTCCTTCAAA pLKO.1 2728 CDS 100% 5.625 3.938 N OPLAH n/a
2 TRCN0000050764 CTGCCTCATCATCGACAGTAA pLKO.1 2166 CDS 100% 4.950 3.465 N OPLAH n/a
3 TRCN0000050767 CTAAACCTGCTGATCCGCAAA pLKO.1 3739 CDS 100% 4.050 2.835 N OPLAH n/a
4 TRCN0000050766 CCCATGCCTGAGGTGCTGTAT pLKO.1 463 CDS 100% 1.650 1.155 N OPLAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017570.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.