Transcript: Human NM_017602.4

Homo sapiens OTU deubiquitinase 5 (OTUD5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
OTUD5 (55593)
Length:
2903
CDS:
38..1753

Additional Resources:

NCBI RefSeq record:
NM_017602.4
NBCI Gene record:
OTUD5 (55593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233198 CATCGGAATATCCACTATAAT pLKO_005 1025 CDS 100% 15.000 21.000 N OTUD5 n/a
2 TRCN0000141847 GCATGCTGAATTGGGCATGAA pLKO.1 1438 CDS 100% 0.495 0.396 N OTUD5 n/a
3 TRCN0000233197 AGGACTTTACCACCTACATTA pLKO_005 828 CDS 100% 13.200 9.240 N OTUD5 n/a
4 TRCN0000233195 ACAACAGTGAGGACGAGTATG pLKO_005 561 CDS 100% 10.800 7.560 N OTUD5 n/a
5 TRCN0000233199 AGAACGTCTGAGCCTTCAATG pLKO_005 2232 3UTR 100% 10.800 7.560 N OTUD5 n/a
6 TRCN0000233196 CCGACTACTTCTCCAACTATG pLKO_005 801 CDS 100% 10.800 7.560 N OTUD5 n/a
7 TRCN0000145601 CACTAGCTTCTTTGGAATCTT pLKO.1 2537 3UTR 100% 5.625 3.938 N OTUD5 n/a
8 TRCN0000141437 CTGACCTTGCTGCATTCCTTT pLKO.1 2504 3UTR 100% 4.950 3.465 N OTUD5 n/a
9 TRCN0000122275 CCATCATTCAAACCAGGGTTT pLKO.1 1094 CDS 100% 4.050 2.835 N OTUD5 n/a
10 TRCN0000143838 CAACAGGAATACCTAGACAGT pLKO.1 1685 CDS 100% 2.640 1.848 N OTUD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.