Transcript: Human NM_017677.4

Homo sapiens myotubularin related protein 8 (MTMR8), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MTMR8 (55613)
Length:
2660
CDS:
90..2204

Additional Resources:

NCBI RefSeq record:
NM_017677.4
NBCI Gene record:
MTMR8 (55613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355751 AGACTGTATCTGGCAATTAAT pLKO_005 1298 CDS 100% 15.000 10.500 N MTMR8 n/a
2 TRCN0000355752 GGCAGCCTTAGGGCCATAAAT pLKO_005 1938 CDS 100% 15.000 10.500 N MTMR8 n/a
3 TRCN0000355753 AGCATTACCTGAAGATCTTTA pLKO_005 398 CDS 100% 13.200 9.240 N MTMR8 n/a
4 TRCN0000002610 CCAACAGAAACTATGAGATAT pLKO.1 541 CDS 100% 13.200 9.240 N MTMR8 n/a
5 TRCN0000002607 GCTCTCAATTAGGAAACATAT pLKO.1 1741 CDS 100% 13.200 9.240 N MTMR8 n/a
6 TRCN0000002609 AGCTGGTTCTACTGTCTGTTT pLKO.1 2478 3UTR 100% 4.950 3.465 N MTMR8 n/a
7 TRCN0000002608 GCCCGGAAAGAAACATGGATT pLKO.1 219 CDS 100% 4.950 3.465 N MTMR8 n/a
8 TRCN0000002606 TGTGGGATGTATAACCGCTTT pLKO.1 1578 CDS 100% 4.050 2.835 N MTMR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.