Transcript: Human NM_017684.5

Homo sapiens vacuolar protein sorting 13 homolog C (VPS13C), transcript variant 1A, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
VPS13C (54832)
Length:
13274
CDS:
74..11206

Additional Resources:

NCBI RefSeq record:
NM_017684.5
NBCI Gene record:
VPS13C (54832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017684.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232493 CCCTATTCGTAGCCCTATTAA pLKO_005 9463 CDS 100% 15.000 21.000 N VPS13C n/a
2 TRCN0000257284 TGCGACCCTGGAAGGATTATA pLKO_005 313 CDS 100% 15.000 21.000 N VPS13C n/a
3 TRCN0000150922 GCAAAGGTCAATAGGCTTATA pLKO.1 11499 3UTR 100% 13.200 10.560 N VPS13C n/a
4 TRCN0000151608 GCAGTAACTAATGCCCTAAAT pLKO.1 12833 3UTR 100% 13.200 10.560 N VPS13C n/a
5 TRCN0000151798 CCTAACTTTACCTAAGCAGTA pLKO.1 1504 CDS 100% 4.050 3.240 N VPS13C n/a
6 TRCN0000232492 CTTAAGGTAGAAGCGAAATTA pLKO_005 1661 CDS 100% 15.000 10.500 N VPS13C n/a
7 TRCN0000232491 GCAGTATGTTGCCCATATTAT pLKO_005 1519 CDS 100% 15.000 10.500 N VPS13C n/a
8 TRCN0000232494 TGTTGACAATGTCCCATATAT pLKO_005 13077 3UTR 100% 15.000 10.500 N VPS13C n/a
9 TRCN0000153352 GCTGTTGACAATGTCCCATAT pLKO.1 13075 3UTR 100% 10.800 7.560 N VPS13C n/a
10 TRCN0000150987 CGGACAAAGTTAATCCAACAA pLKO.1 9830 CDS 100% 4.950 3.465 N VPS13C n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 11867 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 11831 3UTR 100% 4.950 2.475 Y RBM48 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 11867 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017684.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.