Transcript: Human NM_017721.5

Homo sapiens coiled-coil and C2 domain containing 1A (CC2D1A), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CC2D1A (54862)
Length:
3581
CDS:
242..3097

Additional Resources:

NCBI RefSeq record:
NM_017721.5
NBCI Gene record:
CC2D1A (54862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017721.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001341 CGCATCGTCAAGCAATACCAA pLKO.1 1379 CDS 100% 3.000 4.200 N CC2D1A n/a
2 TRCN0000320418 CGCATCGTCAAGCAATACCAA pLKO_005 1379 CDS 100% 3.000 4.200 N CC2D1A n/a
3 TRCN0000320497 ATGTGCCTGAACCACTCAAAC pLKO_005 2006 CDS 100% 10.800 7.560 N CC2D1A n/a
4 TRCN0000320420 CTGGCGATCTGGATGTCTTTG pLKO_005 2265 CDS 100% 10.800 7.560 N CC2D1A n/a
5 TRCN0000001343 GAGTTCAAGGAGCAGTTCAAA pLKO.1 2366 CDS 100% 5.625 3.938 N CC2D1A n/a
6 TRCN0000320494 GAGTTCAAGGAGCAGTTCAAA pLKO_005 2366 CDS 100% 5.625 3.938 N CC2D1A n/a
7 TRCN0000001340 CGAACCAGACAAGCAGACAAT pLKO.1 3170 3UTR 100% 4.950 3.465 N CC2D1A n/a
8 TRCN0000320411 CGAACCAGACAAGCAGACAAT pLKO_005 3170 3UTR 100% 4.950 3.465 N CC2D1A n/a
9 TRCN0000001342 CTGGATGTCTTTGTTCGGTTT pLKO.1 2273 CDS 100% 4.050 2.835 N CC2D1A n/a
10 TRCN0000001344 CCACTCAAACCAATTCACCCA pLKO.1 2017 CDS 100% 0.660 0.462 N CC2D1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017721.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.