Transcript: Human NM_017759.5

Homo sapiens INO80 complex subunit D (INO80D), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
INO80D (54891)
Length:
14128
CDS:
398..3481

Additional Resources:

NCBI RefSeq record:
NM_017759.5
NBCI Gene record:
INO80D (54891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017759.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433041 ATACCAGTGCCCTTTACTATT pLKO_005 3791 3UTR 100% 13.200 18.480 N INO80D n/a
2 TRCN0000426225 CACTACCTGGAAACCGAATTG pLKO_005 818 CDS 100% 10.800 15.120 N INO80D n/a
3 TRCN0000427054 GAAATGCCGGCATACGTTTAG pLKO_005 1585 CDS 100% 10.800 15.120 N INO80D n/a
4 TRCN0000429203 TAGGTGGTTCTAGATAGAATG pLKO_005 3860 3UTR 100% 10.800 15.120 N INO80D n/a
5 TRCN0000146763 CTATTGAATGGGCGTATAGTA pLKO.1 2543 CDS 100% 5.625 7.875 N INO80D n/a
6 TRCN0000127600 CAACATCGTACTCTGGTGATA pLKO.1 2940 CDS 100% 4.950 6.930 N INO80D n/a
7 TRCN0000422555 GTGAACAGTGCGCTAACAAAG pLKO_005 1755 CDS 100% 10.800 8.640 N INO80D n/a
8 TRCN0000419609 ATAAGCCCTTGTGCTCATATA pLKO_005 438 CDS 100% 13.200 9.240 N INO80D n/a
9 TRCN0000147250 GCACTTACTTTCAGCAGAAAT pLKO.1 1521 CDS 100% 13.200 9.240 N INO80D n/a
10 TRCN0000426618 TGAATATGTGGCCAAGTATAA pLKO_005 550 CDS 100% 13.200 9.240 N INO80D n/a
11 TRCN0000436066 AGAGGAGATAACTCCCGTAAA pLKO_005 1952 CDS 100% 10.800 7.560 N INO80D n/a
12 TRCN0000251234 ATGAGTTGCCGGATGACATTG pLKO_005 2187 CDS 100% 10.800 7.560 N Ino80d n/a
13 TRCN0000424506 GAGCAAGGCAGATGACCTAAT pLKO_005 2806 CDS 100% 10.800 7.560 N INO80D n/a
14 TRCN0000149662 GAGCTATTGAATGGGCGTATA pLKO.1 2540 CDS 100% 10.800 7.560 N INO80D n/a
15 TRCN0000129770 CCATTTGCTTTCAATGAGGAA pLKO.1 845 CDS 100% 2.640 1.848 N INO80D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017759.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.