Transcript: Human NM_017990.5

Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-14
Taxon:
Homo sapiens (human)
Gene:
PDPR (55066)
Length:
8549
CDS:
252..2891

Additional Resources:

NCBI RefSeq record:
NM_017990.5
NBCI Gene record:
PDPR (55066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431048 AGAGTACGCCCTGCATGTATA pLKO_005 2300 CDS 100% 13.200 9.240 N PDPR n/a
2 TRCN0000419112 CAGAGCAGCACACCAACTATT pLKO_005 1083 CDS 100% 13.200 9.240 N PDPR n/a
3 TRCN0000417037 AGGAAGACTGGGATCACTTTG pLKO_005 1228 CDS 100% 10.800 7.560 N PDPR n/a
4 TRCN0000036696 GCAGAAGCAGAATGGAGTGTA pLKO.1 2522 CDS 100% 4.950 3.465 N PDPR n/a
5 TRCN0000036698 GCTGAGTGACTTACATGGGAA pLKO.1 2867 CDS 100% 2.640 1.848 N PDPR n/a
6 TRCN0000036697 CGGACATCTGTTCTTCATGTA pLKO.1 876 CDS 100% 4.950 2.970 N PDPR n/a
7 TRCN0000036695 GCCAGGATTCATGCTCTACAT pLKO.1 2273 CDS 100% 4.950 2.475 Y PDPR n/a
8 TRCN0000036694 GCTCAATCTTTCTGGCCCAAA pLKO.1 628 CDS 100% 4.050 2.025 Y PDPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.