Transcript: Human NM_018082.6

Homo sapiens RNA polymerase III subunit B (POLR3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLR3B (55703)
Length:
4183
CDS:
133..3534

Additional Resources:

NCBI RefSeq record:
NM_018082.6
NBCI Gene record:
POLR3B (55703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018082.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053186 CGTGACTGTTTAATCGGTTAT pLKO.1 3286 CDS 100% 10.800 15.120 N POLR3B n/a
2 TRCN0000053185 GCTGTGAAACAAGGACGATTT pLKO.1 781 CDS 100% 10.800 15.120 N POLR3B n/a
3 TRCN0000053187 GCTGACCCTATGTGGTACTTA pLKO.1 337 CDS 100% 5.625 7.875 N POLR3B n/a
4 TRCN0000053184 GCCTCTTTAGACAGAGGCTTT pLKO.1 2410 CDS 100% 0.405 0.324 N POLR3B n/a
5 TRCN0000053183 CCCTACATAATTGTCAAGAAA pLKO.1 1915 CDS 100% 5.625 3.938 N POLR3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018082.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.