Transcript: Human NM_018248.3

Homo sapiens nei like DNA glycosylase 3 (NEIL3), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
NEIL3 (55247)
Length:
2363
CDS:
81..1898

Additional Resources:

NCBI RefSeq record:
NM_018248.3
NBCI Gene record:
NEIL3 (55247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433012 GCTAATGGATCAGAACGTATT pLKO_005 620 CDS 100% 10.800 15.120 N NEIL3 n/a
2 TRCN0000007911 GCTACCGACTAGAAATACTAT pLKO.1 953 CDS 100% 5.625 7.875 N NEIL3 n/a
3 TRCN0000007907 CGGATATACAGCATATTCCAT pLKO.1 2109 3UTR 100% 3.000 4.200 N NEIL3 n/a
4 TRCN0000007908 CGGATTCATTTCGGAATGAAA pLKO.1 357 CDS 100% 0.563 0.788 N NEIL3 n/a
5 TRCN0000007910 GCCTGTTTAATGGATATGTTT pLKO.1 277 CDS 100% 5.625 4.500 N NEIL3 n/a
6 TRCN0000434176 AGAAGACAACAAACGATATAA pLKO_005 1381 CDS 100% 15.000 10.500 N NEIL3 n/a
7 TRCN0000418834 GCATTTAGTAATGACGATAAA pLKO_005 2148 3UTR 100% 13.200 9.240 N NEIL3 n/a
8 TRCN0000436322 TACTGTCTTTAGCCACTTAAT pLKO_005 1148 CDS 100% 13.200 9.240 N NEIL3 n/a
9 TRCN0000007909 CCTGGATATTCTAACAGTGAA pLKO.1 1524 CDS 100% 4.950 3.465 N NEIL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.