Transcript: Human NM_018360.3

Homo sapiens taxilin gamma (TXLNG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TXLNG (55787)
Length:
4362
CDS:
23..1609

Additional Resources:

NCBI RefSeq record:
NM_018360.3
NBCI Gene record:
TXLNG (55787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142856 CAGCGTCACAATAAGACGTTA pLKO.1 668 CDS 100% 4.950 6.930 N TXLNG n/a
2 TRCN0000139267 CGACGTAAAGAAGCAACTGCA pLKO.1 728 CDS 100% 2.640 3.696 N TXLNG n/a
3 TRCN0000140635 GCTCAAATTGTGGTGGCACAA pLKO.1 225 CDS 100% 0.405 0.324 N TXLNG n/a
4 TRCN0000144587 GCAAACGACACAACTGATAAA pLKO.1 949 CDS 100% 13.200 9.240 N TXLNG n/a
5 TRCN0000121858 GCACAAGTAACAAGCATTCAT pLKO.1 240 CDS 100% 5.625 3.938 N TXLNG n/a
6 TRCN0000139886 GCAGCAAACGACACAACTGAT pLKO.1 946 CDS 100% 4.950 3.465 N TXLNG n/a
7 TRCN0000143550 GAGTGAACATAGCAAGGCTAT pLKO.1 607 CDS 100% 4.050 2.835 N TXLNG n/a
8 TRCN0000144613 GCAAGAATCAAGAGAGGAAAT pLKO.1 328 CDS 100% 10.800 6.480 N TXLNG n/a
9 TRCN0000139266 CTCCACTGGAATGCATGTGTT pLKO.1 1831 3UTR 100% 4.950 2.970 N TXLNG n/a
10 TRCN0000143605 GCAAATGAAGATCCTGCAGAA pLKO.1 547 CDS 100% 4.050 2.430 N TXLNG n/a
11 TRCN0000128404 GCAGCTCTCTGTAAGAAATAT pLKO.1 491 CDS 100% 15.000 7.500 Y TXLNGY n/a
12 TRCN0000128355 GCAGATATGTTGTGTAACTCT pLKO.1 176 CDS 100% 3.000 1.500 Y TXLNGY n/a
13 TRCN0000140138 GCACAATGGAAGAAGCTGGAA pLKO.1 135 CDS 100% 2.640 1.320 Y TXLNG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.