Transcript: Human NM_018385.3

Homo sapiens large 60S subunit nuclear export GTPase 1 (LSG1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LSG1 (55341)
Length:
3283
CDS:
30..2006

Additional Resources:

NCBI RefSeq record:
NM_018385.3
NBCI Gene record:
LSG1 (55341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423998 GAGTTACTGGAGCTCTTTAAG pLKO_005 1131 CDS 100% 13.200 18.480 N LSG1 n/a
2 TRCN0000439044 CACGCACCAACATGGAGAAAC pLKO_005 2246 3UTR 100% 10.800 15.120 N LSG1 n/a
3 TRCN0000162074 CCAGATAGTAGATGCTCGAAA pLKO.1 563 CDS 100% 4.950 6.930 N LSG1 n/a
4 TRCN0000163627 GCTAGGGATTCTCCTTCACTT pLKO.1 891 CDS 100% 4.950 6.930 N LSG1 n/a
5 TRCN0000219926 CACTGGTTATTCCACTTATTT pLKO.1 2664 3UTR 100% 15.000 12.000 N LSG1 n/a
6 TRCN0000414572 AGTCATTGAGAGAAGTGATAT pLKO_005 536 CDS 100% 13.200 10.560 N LSG1 n/a
7 TRCN0000219925 ACAGGGAAGCTGCGGTATTTA pLKO.1 2625 3UTR 100% 15.000 10.500 N LSG1 n/a
8 TRCN0000414436 GTTTCGACCAGGCTGAAATTT pLKO_005 844 CDS 100% 15.000 10.500 N LSG1 n/a
9 TRCN0000160046 CCTATGGCATTAACATCATAA pLKO.1 1486 CDS 100% 13.200 9.240 N LSG1 n/a
10 TRCN0000427136 GATGGTTCACGAGACACATTT pLKO_005 2463 3UTR 100% 13.200 9.240 N LSG1 n/a
11 TRCN0000431903 GGTGAAAGATGGGCAACTTAC pLKO_005 1172 CDS 100% 10.800 7.560 N LSG1 n/a
12 TRCN0000159822 GAACTCAATGATGGCTATGAT pLKO.1 141 CDS 100% 5.625 3.938 N LSG1 n/a
13 TRCN0000161473 GAGATCATGTTCCTCCTGTAT pLKO.1 1423 CDS 100% 4.950 3.465 N LSG1 n/a
14 TRCN0000161893 GCCAATAAGGAGAACGTCATT pLKO.1 636 CDS 100% 4.950 3.465 N LSG1 n/a
15 TRCN0000416103 TCATCTGGGAGCCCGAGAATC pLKO_005 2200 3UTR 100% 3.600 2.520 N LSG1 n/a
16 TRCN0000162738 CTCCTGTTTAGATGTGAGGAT pLKO.1 588 CDS 100% 2.640 1.848 N LSG1 n/a
17 TRCN0000158966 GCAGAGAAAGATAACTTTCTA pLKO.1 420 CDS 100% 0.563 0.394 N LSG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.