Transcript: Human NM_018456.6

Homo sapiens ELL associated factor 2 (EAF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EAF2 (55840)
Length:
998
CDS:
78..860

Additional Resources:

NCBI RefSeq record:
NM_018456.6
NBCI Gene record:
EAF2 (55840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018456.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425004 AGAGTTGAAGGAAGCAGTAAA pLKO_005 414 CDS 100% 13.200 18.480 N EAF2 n/a
2 TRCN0000414030 GAAGGCAGAAGCTAGTCTAAT pLKO_005 566 CDS 100% 13.200 18.480 N EAF2 n/a
3 TRCN0000005292 GTGACCATAACTCTGCCAAAT pLKO.1 252 CDS 100% 10.800 15.120 N EAF2 n/a
4 TRCN0000005293 GCTATGACTTCAAACCTGCTT pLKO.1 181 CDS 100% 2.640 3.696 N EAF2 n/a
5 TRCN0000430116 GCCTTCTGATGAATACTTTAA pLKO_005 793 CDS 100% 13.200 9.240 N EAF2 n/a
6 TRCN0000413704 AGGTTCAACTCCACCAGTAAC pLKO_005 278 CDS 100% 10.800 7.560 N EAF2 n/a
7 TRCN0000005290 CTGGAGAATGTCGGCTAGAAA pLKO.1 361 CDS 100% 5.625 3.938 N EAF2 n/a
8 TRCN0000193208 CATCTTCAAGTAGTGAGGATA pLKO.1 634 CDS 100% 4.950 3.465 N Eaf2 n/a
9 TRCN0000005289 CCTGATATAGATGCCAGTCAT pLKO.1 750 CDS 100% 4.950 3.465 N EAF2 n/a
10 TRCN0000005291 GCAAATCCTCTACTTCTGATA pLKO.1 682 CDS 100% 4.950 3.465 N EAF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018456.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.