Transcript: Human NM_018584.6

Homo sapiens calcium/calmodulin dependent protein kinase II inhibitor 1 (CAMK2N1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CAMK2N1 (55450)
Length:
2326
CDS:
832..1068

Additional Resources:

NCBI RefSeq record:
NM_018584.6
NBCI Gene record:
CAMK2N1 (55450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018584.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219773 CGGTGAATATTGCGCAATTAT pLKO.1 1404 3UTR 100% 15.000 21.000 N CAMK2N1 n/a
2 TRCN0000197259 GAACGGCGGTAACAGTTATTG pLKO.1 1104 3UTR 100% 13.200 18.480 N CAMK2N1 n/a
3 TRCN0000037614 CGGGTTGTTATTGAAGATGAT pLKO.1 994 CDS 100% 4.950 6.930 N CAMK2N1 n/a
4 TRCN0000255252 TAGGATTGATGACGTGCTGAA pLKO_005 1014 CDS 100% 4.050 5.670 N Camk2n1 n/a
5 TRCN0000219772 ATATGACCGACAAGGCACCTC pLKO.1 1037 CDS 100% 2.160 3.024 N CAMK2N1 n/a
6 TRCN0000037615 AGGATTGATGACGTGCTGAAA pLKO.1 1015 CDS 100% 4.950 3.465 N CAMK2N1 n/a
7 TRCN0000219771 TATTGAAGATGATAGGATTGA pLKO.1 1002 CDS 100% 4.950 3.465 N CAMK2N1 n/a
8 TRCN0000037616 CCGGAGCAAGCGGGTTGTTAT pLKO.1 984 CDS 100% 4.400 3.080 N CAMK2N1 n/a
9 TRCN0000037618 ACAAGGCACCTCCTGGTGTCT pLKO.1 1046 CDS 100% 0.880 0.616 N CAMK2N1 n/a
10 TRCN0000199309 CACCAACAACTTCTTCGGCGC pLKO.1 924 CDS 100% 0.100 0.070 N CAMK2N1 n/a
11 TRCN0000199664 GATCTTCTCCTGCCGCCTGCA pLKO.1 900 CDS 100% 0.000 0.000 N CAMK2N1 n/a
12 TRCN0000255251 GGACACCAACAACTTCTTCGG pLKO_005 921 CDS 100% 2.160 1.296 N Camk2n1 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1826 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018584.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.