Transcript: Human NM_018663.3

Homo sapiens peroxisomal membrane protein 2 (PXMP2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PXMP2 (5827)
Length:
970
CDS:
85..672

Additional Resources:

NCBI RefSeq record:
NM_018663.3
NBCI Gene record:
PXMP2 (5827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232808 GCCTCTGAGATATGCCGTTTA pLKO_005 297 CDS 100% 10.800 15.120 N PXMP2 n/a
2 TRCN0000180370 GACGCCACTACAGTTCATCAA pLKO.1 561 CDS 100% 4.950 3.960 N PXMP2 n/a
3 TRCN0000232811 GGATGTCACTGACTCTAAATC pLKO_005 757 3UTR 100% 13.200 9.240 N PXMP2 n/a
4 TRCN0000232807 ACTTCCTGGCCCAGATGATTG pLKO_005 230 CDS 100% 10.800 7.560 N PXMP2 n/a
5 TRCN0000232810 TGGCAGCTCTGTTCTGGTATG pLKO_005 626 CDS 100% 6.000 4.200 N PXMP2 n/a
6 TRCN0000232809 ACTACAGTTCATCAACATCAA pLKO_005 567 CDS 100% 4.950 3.465 N PXMP2 n/a
7 TRCN0000147110 CAGTTCATCAACATCAACTAC pLKO.1 571 CDS 100% 4.950 3.465 N PXMP2 n/a
8 TRCN0000149373 GAATGTCAGAACCCTGTCTTT pLKO.1 827 3UTR 100% 4.950 3.465 N PXMP2 n/a
9 TRCN0000183165 GAGAAACAGAAATCTCTGAAT pLKO.1 810 3UTR 100% 4.950 3.465 N PXMP2 n/a
10 TRCN0000150275 GAGTCACTTCTTCTACTTCTT pLKO.1 342 CDS 100% 4.950 3.465 N PXMP2 n/a
11 TRCN0000148672 CCTCATGTTGTTCTTCCTCAT pLKO.1 447 CDS 100% 4.050 2.835 N PXMP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.