Transcript: Human NM_018672.4

Homo sapiens ATP binding cassette subfamily A member 5 (ABCA5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
ABCA5 (23461)
Length:
9249
CDS:
1219..6147

Additional Resources:

NCBI RefSeq record:
NM_018672.4
NBCI Gene record:
ABCA5 (23461)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018672.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427287 TCTGATGGGTTTGCATCTATA pLKO_005 2818 CDS 100% 13.200 18.480 N ABCA5 n/a
2 TRCN0000060297 CGACATATTGTATGGAATCTT pLKO.1 3166 CDS 100% 5.625 7.875 N ABCA5 n/a
3 TRCN0000060296 GCCATTGAAGAATATAGCTTT pLKO.1 5998 CDS 100% 4.950 6.930 N ABCA5 n/a
4 TRCN0000412893 ATATACTCCAGTGACTAATAT pLKO_005 1458 CDS 100% 15.000 10.500 N ABCA5 n/a
5 TRCN0000060293 GCCATAAGAATTAGTGGTATT pLKO.1 2647 CDS 100% 10.800 7.560 N ABCA5 n/a
6 TRCN0000060294 CCATCCATTATGGTCAGCAAT pLKO.1 5080 CDS 100% 4.950 3.465 N ABCA5 n/a
7 TRCN0000060295 GCATTGTGATATTTCTGCTTT pLKO.1 2105 CDS 100% 4.950 3.465 N ABCA5 n/a
8 TRCN0000416047 GGATACACAATTGCAACTATT pLKO_005 4693 CDS 100% 13.200 7.920 N ABCA5 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 18 5UTR 100% 4.950 2.475 Y n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 89 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 89 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018672.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.