Transcript: Human NM_018689.3

Homo sapiens cell migration inducing hyaluronidase 1 (CEMIP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CEMIP (57214)
Length:
7194
CDS:
262..4347

Additional Resources:

NCBI RefSeq record:
NM_018689.3
NBCI Gene record:
CEMIP (57214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265132 TGAACGTCTGGTCCAGTATTT pLKO_005 909 CDS 100% 13.200 18.480 N Cemip n/a
2 TRCN0000118789 GCCACTACAATGGATGGAGTT pLKO.1 1348 CDS 100% 4.050 5.670 N CEMIP n/a
3 TRCN0000118791 CGAATGAAGATCATCAAGAAT pLKO.1 3304 CDS 100% 5.625 4.500 N CEMIP n/a
4 TRCN0000118790 GCGAATGAAGATCATCAAGAA pLKO.1 3303 CDS 100% 4.950 3.465 N CEMIP n/a
5 TRCN0000118788 CCCAGGTTATTCAGAGCACAT pLKO.1 2397 CDS 100% 4.050 2.835 N CEMIP n/a
6 TRCN0000118787 CCAGGAATGTTGAATGTCTTT pLKO.1 6641 3UTR 100% 4.950 2.970 N CEMIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.