Transcript: Human NM_018697.3

Homo sapiens LanC like 2 (LANCL2), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
LANCL2 (55915)
Length:
4353
CDS:
579..1931

Additional Resources:

NCBI RefSeq record:
NM_018697.3
NBCI Gene record:
LANCL2 (55915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412452 ACTCTTCGAAGAGGGATTAAA pLKO_005 1912 CDS 100% 15.000 21.000 N LANCL2 n/a
2 TRCN0000428486 CAGCACCCTCATCAATATAAA pLKO_005 2099 3UTR 100% 15.000 21.000 N LANCL2 n/a
3 TRCN0000413563 CCGATCCCTGGATTACGTAAA pLKO_005 959 CDS 100% 10.800 15.120 N LANCL2 n/a
4 TRCN0000045405 GCAGGCGTACAAGGTCTTTAA pLKO.1 1574 CDS 100% 13.200 10.560 N LANCL2 n/a
5 TRCN0000417953 GGTCTATCCTAGTGATAATAC pLKO_005 2361 3UTR 100% 13.200 10.560 N LANCL2 n/a
6 TRCN0000045404 CGGGAAGATCATTCATAATTT pLKO.1 776 CDS 100% 15.000 10.500 N LANCL2 n/a
7 TRCN0000418791 CGAAGCCATCCATCAACATTT pLKO_005 2073 3UTR 100% 13.200 9.240 N LANCL2 n/a
8 TRCN0000045406 GCATGGCTGGAATTTACTATA pLKO.1 1372 CDS 100% 13.200 9.240 N LANCL2 n/a
9 TRCN0000045407 GCATTCCTGACAGACCCTATT pLKO.1 1804 CDS 100% 10.800 7.560 N LANCL2 n/a
10 TRCN0000045403 GCAGGTTATCTGTATGCCTTA pLKO.1 1179 CDS 100% 4.050 2.835 N LANCL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.