Transcript: Mouse NM_018755.2

Mus musculus carboxypeptidase Q (Cpq), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cpq (54381)
Length:
2013
CDS:
306..1718

Additional Resources:

NCBI RefSeq record:
NM_018755.2
NBCI Gene record:
Cpq (54381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032315 GCGAACATTTCGAGAAATAAA pLKO.1 389 CDS 100% 15.000 21.000 N Cpq n/a
2 TRCN0000335652 GCGAACATTTCGAGAAATAAA pLKO_005 389 CDS 100% 15.000 21.000 N Cpq n/a
3 TRCN0000032314 CCCAGTATTATGAGCTACATA pLKO.1 1330 CDS 100% 5.625 7.875 N Cpq n/a
4 TRCN0000032318 CGTGATGACTTGTACAAGTAT pLKO.1 1566 CDS 100% 5.625 4.500 N Cpq n/a
5 TRCN0000335653 CGTGATGACTTGTACAAGTAT pLKO_005 1566 CDS 100% 5.625 4.500 N Cpq n/a
6 TRCN0000348575 ATGGAGAAGGAACTGATATTA pLKO_005 1507 CDS 100% 15.000 10.500 N Cpq n/a
7 TRCN0000032317 CCAGATACTGATTCCTTCAAT pLKO.1 1089 CDS 100% 5.625 3.938 N Cpq n/a
8 TRCN0000032316 GCTGTATTCAAGAATGGTGTT pLKO.1 363 CDS 100% 4.050 2.835 N Cpq n/a
9 TRCN0000335651 GCTGTATTCAAGAATGGTGTT pLKO_005 363 CDS 100% 4.050 2.835 N Cpq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.