Transcript: Mouse NM_018773.2

Mus musculus src family associated phosphoprotein 2 (Skap2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Skap2 (54353)
Length:
1656
CDS:
149..1225

Additional Resources:

NCBI RefSeq record:
NM_018773.2
NBCI Gene record:
Skap2 (54353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353315 ACAAACGTATCTATCAGTTTA pLKO_005 726 CDS 100% 13.200 18.480 N Skap2 n/a
2 TRCN0000176498 CCAATCGATGATGAGATTTAT pLKO.1 908 CDS 100% 15.000 10.500 N Skap2 n/a
3 TRCN0000336282 CCAATCGATGATGAGATTTAT pLKO_005 908 CDS 100% 15.000 10.500 N Skap2 n/a
4 TRCN0000374786 TGCTGAGGACGGCGATGAATA pLKO_005 352 CDS 100% 13.200 9.240 N Skap2 n/a
5 TRCN0000217823 CACTGTGATTGTACGTGAATC pLKO.1 1486 3UTR 100% 10.800 7.560 N Skap2 n/a
6 TRCN0000177115 GATGGGTTACATTAGATACAA pLKO.1 1386 3UTR 100% 5.625 3.938 N Skap2 n/a
7 TRCN0000353314 GATGGGTTACATTAGATACAA pLKO_005 1386 3UTR 100% 5.625 3.938 N Skap2 n/a
8 TRCN0000177938 GCGTGGTGATGTGATTTACAT pLKO.1 1102 CDS 100% 5.625 3.938 N Skap2 n/a
9 TRCN0000176772 CGCTACGATAAAGATGATGAT pLKO.1 422 CDS 100% 4.950 3.465 N Skap2 n/a
10 TRCN0000197714 GATGAATATGACGATCCCTTT pLKO.1 365 CDS 100% 4.050 2.835 N Skap2 n/a
11 TRCN0000198674 CCCTGAGGAAATTAGGAACCT pLKO.1 187 CDS 100% 2.640 1.848 N Skap2 n/a
12 TRCN0000178611 CAGACACACTGAAAGGAGAAA pLKO.1 234 CDS 100% 4.950 2.970 N Skap2 n/a
13 TRCN0000353378 CAGACACACTGAAAGGAGAAA pLKO_005 234 CDS 100% 4.950 2.970 N Skap2 n/a
14 TRCN0000029777 GCAGATGTTGAAACATTTGTA pLKO.1 212 CDS 100% 5.625 3.375 N SKAP2 n/a
15 TRCN0000344002 GCAGATGTTGAAACATTTGTA pLKO_005 212 CDS 100% 5.625 3.375 N SKAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.