Transcript: Mouse NM_018810.2

Mus musculus makorin, ring finger protein, 1 (Mkrn1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mkrn1 (54484)
Length:
2936
CDS:
87..1532

Additional Resources:

NCBI RefSeq record:
NM_018810.2
NBCI Gene record:
Mkrn1 (54484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311422 ACGGCGTAGTGTGCAAGTATT pLKO_005 343 CDS 100% 13.200 18.480 N Mkrn1 n/a
2 TRCN0000305848 CAACAAGGCGTGCAGGTATTT pLKO_005 1184 CDS 100% 13.200 18.480 N Mkrn1 n/a
3 TRCN0000305846 GCCGGATCACATCTAACTTTG pLKO_005 1087 CDS 100% 10.800 15.120 N Mkrn1 n/a
4 TRCN0000041203 GCGAGATGTTGCTTATGCTTT pLKO.1 1417 CDS 100% 4.950 6.930 N Mkrn1 n/a
5 TRCN0000305847 AGCTGTTCCCTGCCCTGTAAT pLKO_005 1996 3UTR 100% 13.200 9.240 N Mkrn1 n/a
6 TRCN0000041205 CCAGAGGTCACAGCACATAAA pLKO.1 836 CDS 100% 13.200 9.240 N Mkrn1 n/a
7 TRCN0000041207 GTGTTGGATCACTTGCTGAAA pLKO.1 496 CDS 100% 4.950 3.465 N Mkrn1 n/a
8 TRCN0000324883 GTGTTGGATCACTTGCTGAAA pLKO_005 496 CDS 100% 4.950 3.465 N Mkrn1 n/a
9 TRCN0000041204 CTGTCTCAAGTGTATTCGCAA pLKO.1 1013 CDS 100% 2.640 1.848 N Mkrn1 n/a
10 TRCN0000041206 GAGTGGGACTTGTTTCACGAT pLKO.1 1479 CDS 100% 2.640 1.848 N Mkrn1 n/a
11 TRCN0000033722 GAAGAGAAGCAGAAACTCATT pLKO.1 1140 CDS 100% 4.950 2.970 N MKRN4P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.