Transcript: Mouse NM_018816.1

Mus musculus apolipoprotein M (Apom), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Apom (55938)
Length:
731
CDS:
30..602

Additional Resources:

NCBI RefSeq record:
NM_018816.1
NBCI Gene record:
Apom (55938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105041 CACGGAAGAGTTGGCAACTTT pLKO.1 197 CDS 100% 5.625 7.875 N Apom n/a
2 TRCN0000105044 TCAACTAACTGCGCTGGGAAT pLKO.1 110 CDS 100% 4.050 5.670 N Apom n/a
3 TRCN0000105042 CGTGCTACCATCCGCACGAAA pLKO.1 282 CDS 100% 0.165 0.231 N Apom n/a
4 TRCN0000371396 AGCGCTTTCTCCTCTACAATC pLKO_005 460 CDS 100% 10.800 7.560 N APOM n/a
5 TRCN0000105040 CCAGGAGGAATCATGCTGAAA pLKO.1 420 CDS 100% 4.950 3.465 N Apom n/a
6 TRCN0000105043 CCGGAAGTGGACATACCGATT pLKO.1 320 CDS 100% 4.050 2.835 N Apom n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.