Transcript: Mouse NM_018823.2

Mus musculus nuclear factor of activated T cells 5 (Nfat5), transcript variant b, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Nfat5 (54446)
Length:
13389
CDS:
357..5015

Additional Resources:

NCBI RefSeq record:
NM_018823.2
NBCI Gene record:
Nfat5 (54446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229557 TGCGGACAGTATCCGGTTAAA pLKO_005 1218 CDS 100% 13.200 18.480 N Nfat5 n/a
2 TRCN0000229558 CAATGATTCTGGTCGAGTAAA pLKO_005 1406 CDS 100% 13.200 10.560 N Nfat5 n/a
3 TRCN0000229559 TAGAGTAACTGGGCGAAATAC pLKO_005 1451 CDS 100% 13.200 10.560 N Nfat5 n/a
4 TRCN0000085644 GCAATGATTCTGGTCGAGTAA pLKO.1 1405 CDS 100% 4.950 3.960 N Nfat5 n/a
5 TRCN0000229560 TCCGTATCATGACCAACATAT pLKO_005 1937 CDS 100% 13.200 9.240 N Nfat5 n/a
6 TRCN0000020023 CGGACAACAAAGGCAACTCAA pLKO.1 1135 CDS 100% 4.950 3.465 N NFAT5 n/a
7 TRCN0000085646 GCAGAACAACATCCCTGGAAT pLKO.1 4622 CDS 100% 4.950 3.465 N Nfat5 n/a
8 TRCN0000085647 CCACCATGTTTCAGACACCAA pLKO.1 3337 CDS 100% 2.640 1.848 N Nfat5 n/a
9 TRCN0000085643 CCCAACATATTTCTTTCCCAA pLKO.1 3813 CDS 100% 2.640 1.848 N Nfat5 n/a
10 TRCN0000085645 GCGAAATACAACTCCCTGCAA pLKO.1 1463 CDS 100% 2.640 1.848 N Nfat5 n/a
11 TRCN0000218916 ACCATATTCCTGCTCGAATAT pLKO_005 8033 3UTR 100% 1.320 0.924 N Nfat5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.