Transcript: Mouse NM_018832.2

Mus musculus MAGI family member, X-linked (Magix), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Magix (54634)
Length:
2802
CDS:
92..1066

Additional Resources:

NCBI RefSeq record:
NM_018832.2
NBCI Gene record:
Magix (54634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105826 GCCTCATGCTACTCTTGTGAA pLKO.1 337 CDS 100% 4.950 6.930 N Magix n/a
2 TRCN0000105827 CACTTCCAGTAACCCAGAATA pLKO.1 408 CDS 100% 13.200 9.240 N Magix n/a
3 TRCN0000420223 AGTCCAGAGGCAGTGGCTATT pLKO_005 872 CDS 100% 10.800 7.560 N Magix n/a
4 TRCN0000421302 CACTAGGTGAGGTCCCATAAG pLKO_005 1090 3UTR 100% 10.800 7.560 N Magix n/a
5 TRCN0000415898 TGGAGTCTCGCAGCACCATTT pLKO_005 807 CDS 100% 10.800 7.560 N Magix n/a
6 TRCN0000105828 AGGGTGTTAGTGGTCTGGATT pLKO.1 285 CDS 100% 4.950 3.465 N Magix n/a
7 TRCN0000105825 CCTTAGAGCTTTAACCTGGTT pLKO.1 1148 3UTR 100% 2.640 1.848 N Magix n/a
8 TRCN0000105829 TCACTTTAAGTGGAGGCCGAA pLKO.1 510 CDS 100% 2.160 1.512 N Magix n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.