Transcript: Human NM_018957.5

Homo sapiens SH3 domain binding protein 1 (SH3BP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SH3BP1 (23616)
Length:
2660
CDS:
120..2225

Additional Resources:

NCBI RefSeq record:
NM_018957.5
NBCI Gene record:
SH3BP1 (23616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018957.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422498 AGCAATGCAGGGACGAGTACT pLKO_005 727 CDS 100% 4.950 6.930 N SH3BP1 n/a
2 TRCN0000047862 CCTGGAGATTCAGGCCGATTA pLKO.1 809 CDS 100% 10.800 7.560 N SH3BP1 n/a
3 TRCN0000428123 CACGATGGCTGAGAGCTTCAA pLKO_005 356 CDS 100% 4.950 3.465 N SH3BP1 n/a
4 TRCN0000047860 GAAGCGTCTCAAGCAGACAAT pLKO.1 1079 CDS 100% 4.950 3.465 N SH3BP1 n/a
5 TRCN0000047858 GTTACCAAGGAGGACTCCTAT pLKO.1 768 CDS 100% 4.950 3.465 N SH3BP1 n/a
6 TRCN0000047861 CGACCTCTATGATGACTGGAT pLKO.1 1205 CDS 100% 2.640 1.848 N SH3BP1 n/a
7 TRCN0000047859 CCAGTCTCTTTGAGTAACCCT pLKO.1 2079 CDS 100% 0.750 0.525 N SH3BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018957.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.