Transcript: Human NM_019004.2

Homo sapiens ankyrin repeat and IBR domain containing 1 (ANKIB1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ANKIB1 (54467)
Length:
6340
CDS:
637..3906

Additional Resources:

NCBI RefSeq record:
NM_019004.2
NBCI Gene record:
ANKIB1 (54467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247685 ATAGTAAATCCCACGATTATT pLKO_005 4914 3UTR 100% 15.000 21.000 N ANKIB1 n/a
2 TRCN0000247686 TTCGTCCACTGGAGGTTATTA pLKO_005 2304 CDS 100% 15.000 21.000 N ANKIB1 n/a
3 TRCN0000197372 CGATACCTACAGTTTGATATT pLKO.1 1843 CDS 100% 13.200 18.480 N Ankib1 n/a
4 TRCN0000341406 CGATACCTACAGTTTGATATT pLKO_005 1843 CDS 100% 13.200 18.480 N Ankib1 n/a
5 TRCN0000121722 CGCATTCTCAAGTGTTCTTAT pLKO.1 2608 CDS 100% 13.200 18.480 N ANKIB1 n/a
6 TRCN0000247687 CTAACGAAACAAGGGTCAAAT pLKO_005 1933 CDS 100% 13.200 18.480 N ANKIB1 n/a
7 TRCN0000247688 CCAATTGTCTCTGGTTATTAA pLKO_005 2156 CDS 100% 15.000 10.500 N ANKIB1 n/a
8 TRCN0000247684 CCACCACCAAGTGGGTATAAT pLKO_005 1507 CDS 100% 15.000 10.500 N ANKIB1 n/a
9 TRCN0000121750 CCCAACATCAATGACAATCTT pLKO.1 3523 CDS 100% 5.625 3.938 N ANKIB1 n/a
10 TRCN0000122271 CCACAGAAGATGATTTCAGAA pLKO.1 953 CDS 100% 4.950 2.970 N ANKIB1 n/a
11 TRCN0000176655 CCATGAGCATAGTTATCAGTT pLKO.1 2457 CDS 100% 4.950 3.465 N Ankib1 n/a
12 TRCN0000341407 CCATGAGCATAGTTATCAGTT pLKO_005 2457 CDS 100% 4.950 3.465 N Ankib1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.