Transcript: Human NM_019022.5

Homo sapiens thioredoxin related transmembrane protein 3 (TMX3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TMX3 (54495)
Length:
4737
CDS:
128..1492

Additional Resources:

NCBI RefSeq record:
NM_019022.5
NBCI Gene record:
TMX3 (54495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019022.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054303 CCACAGTTGTTGTACTTGATA pLKO.1 168 CDS 100% 5.625 7.875 N TMX3 n/a
2 TRCN0000054305 CCAACTGTAGTTGTACTGAAT pLKO.1 1046 CDS 100% 4.950 6.930 N TMX3 n/a
3 TRCN0000054307 CATACCAGATTGAAGTCAATT pLKO.1 914 CDS 100% 13.200 10.560 N TMX3 n/a
4 TRCN0000416002 CACTTTAAGGAGAACTAATAA pLKO_005 1942 3UTR 100% 15.000 10.500 N TMX3 n/a
5 TRCN0000054304 CCGACACAGATGGAGGTTATA pLKO.1 1323 CDS 100% 13.200 9.240 N TMX3 n/a
6 TRCN0000433224 GTATCAAGATTATGAGGTTAA pLKO_005 1973 3UTR 100% 10.800 7.560 N TMX3 n/a
7 TRCN0000054306 GCTACTTCCTATTCTAGCATT pLKO.1 377 CDS 100% 4.950 2.970 N TMX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019022.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.