Transcript: Human NM_019095.6

Homo sapiens cardiolipin synthase 1 (CRLS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
CRLS1 (54675)
Length:
3925
CDS:
125..1030

Additional Resources:

NCBI RefSeq record:
NM_019095.6
NBCI Gene record:
CRLS1 (54675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019095.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130512 GCTTGACCTATGCAGATCTTA pLKO.1 672 CDS 100% 5.625 7.875 N CRLS1 n/a
2 TRCN0000280807 GCTTGACCTATGCAGATCTTA pLKO_005 672 CDS 100% 5.625 7.875 N CRLS1 n/a
3 TRCN0000129647 CTTGACCTATGCAGATCTTAT pLKO.1 673 CDS 100% 13.200 9.240 N CRLS1 n/a
4 TRCN0000128187 CAATCCCGAATATGTTGTCAA pLKO.1 447 CDS 100% 4.950 3.465 N CRLS1 n/a
5 TRCN0000280732 CAATCCCGAATATGTTGTCAA pLKO_005 447 CDS 100% 4.950 3.465 N CRLS1 n/a
6 TRCN0000128848 GAAAGTCATCCCTCACTGTTA pLKO.1 1032 3UTR 100% 4.950 3.465 N CRLS1 n/a
7 TRCN0000280809 GAAAGTCATCCCTCACTGTTA pLKO_005 1032 3UTR 100% 4.950 3.465 N CRLS1 n/a
8 TRCN0000128238 GTAATGTTGATTGCTGCTGTT pLKO.1 731 CDS 100% 4.050 2.835 N CRLS1 n/a
9 TRCN0000280730 GTAATGTTGATTGCTGCTGTT pLKO_005 731 CDS 100% 4.050 2.835 N CRLS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019095.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.