Transcript: Human NM_019114.4

Homo sapiens erythrocyte membrane protein band 4.1 like 4B (EPB41L4B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
EPB41L4B (54566)
Length:
5814
CDS:
519..3221

Additional Resources:

NCBI RefSeq record:
NM_019114.4
NBCI Gene record:
EPB41L4B (54566)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019114.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423454 GGATCATGCCAAACCCATAAA pLKO_005 938 CDS 100% 13.200 18.480 N EPB41L4B n/a
2 TRCN0000062393 CGCTAGTGTAAGAAGTCCTAT pLKO.1 2453 CDS 100% 4.950 6.930 N EPB41L4B n/a
3 TRCN0000062395 CGGGTGATCTTCTGATGGATT pLKO.1 2779 CDS 100% 4.950 3.960 N EPB41L4B n/a
4 TRCN0000414757 AGACTTCAGAGACAGTAAATT pLKO_005 3008 CDS 100% 15.000 10.500 N EPB41L4B n/a
5 TRCN0000424094 ACATTCCCGGTTGATACAATG pLKO_005 2943 CDS 100% 10.800 7.560 N EPB41L4B n/a
6 TRCN0000062397 CCGGAGACATTCAACGTTCAA pLKO.1 1775 CDS 100% 4.950 3.465 N EPB41L4B n/a
7 TRCN0000062396 CCTGCTTATGCTTTACACTTT pLKO.1 978 CDS 100% 4.950 3.465 N EPB41L4B n/a
8 TRCN0000062394 GCCCATCTAAAGAAGCTGGAA pLKO.1 2193 CDS 100% 2.640 1.584 N EPB41L4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019114.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.