Transcript: Mouse NM_019388.3

Mus musculus CD86 antigen (Cd86), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cd86 (12524)
Length:
2539
CDS:
117..1046

Additional Resources:

NCBI RefSeq record:
NM_019388.3
NBCI Gene record:
Cd86 (12524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419626 CTGAGTGAGCTGGTAGTATTT pLKO_005 264 CDS 100% 13.200 18.480 N Cd86 n/a
2 TRCN0000424554 TGGTTCTGTACGAGCACTATT pLKO_005 304 CDS 100% 13.200 18.480 N Cd86 n/a
3 TRCN0000067937 CCGTTGTGTGTGTTCTGGAAA pLKO.1 754 CDS 100% 4.950 6.930 N Cd86 n/a
4 TRCN0000067934 GCCCATTTACAAAGGCTCAAA pLKO.1 235 CDS 100% 4.950 6.930 N Cd86 n/a
5 TRCN0000067935 CCTCTAAGTTAGAGCGGGATA pLKO.1 949 CDS 100% 4.050 5.670 N Cd86 n/a
6 TRCN0000432435 TACACAACAGTGTCCATATTT pLKO_005 1174 3UTR 100% 15.000 10.500 N Cd86 n/a
7 TRCN0000067933 CCCAGACTTAAAGAGAACTTT pLKO.1 2319 3UTR 100% 5.625 3.938 N Cd86 n/a
8 TRCN0000067936 CCCGAAACCTAAGAAGATGTA pLKO.1 605 CDS 100% 4.950 3.465 N Cd86 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.