Transcript: Mouse NM_019397.3

Mus musculus EGF-like-domain, multiple 6 (Egfl6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Egfl6 (54156)
Length:
2700
CDS:
194..1846

Additional Resources:

NCBI RefSeq record:
NM_019397.3
NBCI Gene record:
Egfl6 (54156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119298 CGCCGATATGATTGTGTAGAT pLKO.1 824 CDS 100% 4.950 6.930 N Egfl6 n/a
2 TRCN0000119299 CCGAATAAATGTAGATGCTTT pLKO.1 416 CDS 100% 4.950 3.960 N Egfl6 n/a
3 TRCN0000119300 GCCGATATGATTGTGTAGATA pLKO.1 825 CDS 100% 5.625 3.938 N Egfl6 n/a
4 TRCN0000119297 GCCTTCTCATTTGTTTCTGAA pLKO.1 2047 3UTR 100% 4.950 3.465 N Egfl6 n/a
5 TRCN0000119301 GCTGATCGAGACAATGATGTT pLKO.1 1454 CDS 100% 4.950 3.465 N Egfl6 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2412 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.