Transcript: Mouse NM_019406.3

Mus musculus formin binding protein 1 (Fnbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fnbp1 (14269)
Length:
1983
CDS:
207..1223

Additional Resources:

NCBI RefSeq record:
NM_019406.3
NBCI Gene record:
Fnbp1 (14269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338106 CTGGTCGTAGAAGCCTATAAG pLKO_005 1005 CDS 100% 13.200 18.480 N Fnbp1 n/a
2 TRCN0000179936 CGTGTTTACCTCTGGCTTAAA pLKO.1 1743 3UTR 100% 13.200 10.560 N Fnbp1 n/a
3 TRCN0000350892 GTTAGTGTGCTGCGTTCAATT pLKO_005 1305 3UTR 100% 13.200 10.560 N Fnbp1 n/a
4 TRCN0000338104 AGAGGCGGATTGTGCGTATTG pLKO_005 868 CDS 100% 10.800 8.640 N Fnbp1 n/a
5 TRCN0000338036 TCAAGGAGAGGACGGAGATTG pLKO_005 301 CDS 100% 10.800 7.560 N Fnbp1 n/a
6 TRCN0000184131 CCAGGAGCAATGGGAATACTA pLKO.1 800 CDS 100% 5.625 3.938 N Fnbp1 n/a
7 TRCN0000184445 GCCTTTCTTTCCACCCTGAAT pLKO.1 420 CDS 100% 4.950 3.465 N Fnbp1 n/a
8 TRCN0000338034 GCCTTTCTTTCCACCCTGAAT pLKO_005 420 CDS 100% 4.950 3.465 N Fnbp1 n/a
9 TRCN0000179098 CCAACCTAAGAAGAACTCGAA pLKO.1 365 CDS 100% 2.640 1.848 N Fnbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.