Transcript: Mouse NM_019408.3

Mus musculus nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100 (Nfkb2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nfkb2 (18034)
Length:
3205
CDS:
310..3009

Additional Resources:

NCBI RefSeq record:
NM_019408.3
NBCI Gene record:
Nfkb2 (18034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012343 CCTGTCTAATCGAAATCTTAT pLKO.1 3053 3UTR 100% 13.200 18.480 N Nfkb2 n/a
2 TRCN0000360375 CGCGGTGGAGACGAAGTTTAT pLKO_005 1030 CDS 100% 13.200 18.480 N Nfkb2 n/a
3 TRCN0000235405 GCAGATAGCCCACGTCATTTA pLKO_005 1824 CDS 100% 13.200 18.480 N Nfkb2 n/a
4 TRCN0000360373 CGAGGCTTCAGATTTCGATAT pLKO_005 454 CDS 100% 10.800 15.120 N Nfkb2 n/a
5 TRCN0000012347 CGGACTCCAAACAGTTCACAT pLKO.1 1262 CDS 100% 4.950 6.930 N Nfkb2 n/a
6 TRCN0000012346 CGTCATTTATCACGCTCAGTA pLKO.1 1836 CDS 100% 4.950 6.930 N Nfkb2 n/a
7 TRCN0000012344 GCGAGGCTTCAGATTTCGATA pLKO.1 453 CDS 100% 4.950 6.930 N Nfkb2 n/a
8 TRCN0000356047 ACATTGAGGTTCGGTTCTATG pLKO_005 1079 CDS 100% 10.800 8.640 N NFKB2 n/a
9 TRCN0000360444 ACATTGAGGTTCGGTTCTATG pLKO_005 1079 CDS 100% 10.800 8.640 N Nfkb2 n/a
10 TRCN0000235402 GGCAGTCTCCTTCGTAGTTAC pLKO_005 2752 CDS 100% 10.800 8.640 N Nfkb2 n/a
11 TRCN0000235406 AGGACATGACTGCTCAATTTA pLKO_005 689 CDS 100% 15.000 10.500 N Nfkb2 n/a
12 TRCN0000360374 CTCCAAACAGTTCACATATTA pLKO_005 1266 CDS 100% 15.000 10.500 N Nfkb2 n/a
13 TRCN0000235404 CTCTCCCACAGACGTTCATAA pLKO_005 1137 CDS 100% 13.200 9.240 N Nfkb2 n/a
14 TRCN0000012345 CCTGCATGTAACCAAGAAGAA pLKO.1 723 CDS 100% 4.950 3.465 N Nfkb2 n/a
15 TRCN0000235403 CAGATCCCTCTGTACAGCATC pLKO_005 3032 3UTR 100% 4.050 2.835 N Nfkb2 n/a
16 TRCN0000360301 TCTTACTCGCCTCCTTCTAAA pLKO_005 2355 CDS 100% 13.200 7.920 N Nfkb2 n/a
17 TRCN0000006512 GCTGCTAAATGCTGCTCAGAA pLKO.1 2544 CDS 100% 4.950 2.970 N NFKB2 n/a
18 TRCN0000006514 CCCTATCACAAGATGAAGATT pLKO.1 1186 CDS 100% 5.625 3.938 N NFKB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.