Transcript: Mouse NM_019412.2

Mus musculus periaxin (Prx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prx (19153)
Length:
5260
CDS:
286..732

Additional Resources:

NCBI RefSeq record:
NM_019412.2
NBCI Gene record:
Prx (19153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104963 CTACAAGGTCTCCTTCTGCTT pLKO.1 552 CDS 100% 2.640 1.848 N Prx n/a
2 TRCN0000104961 GAGAACTTCAAATATGAGGAT pLKO.1 502 CDS 100% 2.640 1.848 N Prx n/a
3 TRCN0000423263 CAAGCTGGTACGCGTGCTTAG pLKO_005 660 CDS 100% 2.000 1.400 N PRX n/a
4 TRCN0000104962 CCAAGCTGGTACGCGTGCTTA pLKO.1 659 CDS 100% 1.650 1.155 N Prx n/a
5 TRCN0000104964 CGGCAAAGAAGGAATCTTTGT pLKO.1 396 CDS 100% 0.495 0.347 N Prx n/a
6 TRCN0000104960 CCTGACATTAAACTTCCTGAA pLKO.1 2876 3UTR 100% 4.050 2.430 N Prx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.