Transcript: Mouse NM_019445.2

Mus musculus formin 2 (Fmn2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fmn2 (54418)
Length:
6461
CDS:
222..4958

Additional Resources:

NCBI RefSeq record:
NM_019445.2
NBCI Gene record:
Fmn2 (54418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417587 ACGCCAAGTCTCTCGACAAAC pLKO_005 4069 CDS 100% 10.800 15.120 N Fmn2 n/a
2 TRCN0000120514 GCCCTACAATTTAGCAATCTA pLKO.1 2862 CDS 100% 5.625 7.875 N Fmn2 n/a
3 TRCN0000436860 GGACAGCGCTCACTCTATAGT pLKO_005 533 CDS 100% 5.625 7.875 N Fmn2 n/a
4 TRCN0000365637 TGCTTCAGGGAACCGTGTAAT pLKO_005 1881 CDS 100% 13.200 10.560 N FMN2 n/a
5 TRCN0000447130 TGCTTCAGGGAACCGTGTAAT pLKO_005 1881 CDS 100% 13.200 10.560 N Fmn2 n/a
6 TRCN0000120515 GCCCTGACAGAGACTCATAAA pLKO.1 4677 CDS 100% 13.200 9.240 N Fmn2 n/a
7 TRCN0000120516 GCTGAGCTAGAGAAGCAATAT pLKO.1 2223 CDS 100% 13.200 9.240 N Fmn2 n/a
8 TRCN0000417286 CAGTCCCAAGGACGTTGATAC pLKO_005 2060 CDS 100% 10.800 7.560 N Fmn2 n/a
9 TRCN0000120513 GCCTCTCTATTGGACAAGAAT pLKO.1 3671 CDS 100% 5.625 3.938 N Fmn2 n/a
10 TRCN0000120512 GCCTATGGTTTCTCTCTTGTT pLKO.1 5271 3UTR 100% 4.950 3.465 N Fmn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.