Transcript: Mouse NM_019538.4

Mus musculus placental specific protein 1 (Plac1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Plac1 (56096)
Length:
1070
CDS:
241..762

Additional Resources:

NCBI RefSeq record:
NM_019538.4
NBCI Gene record:
Plac1 (56096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019538.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200489 CCACCTTATGTCTACAATCAA pLKO.1 730 CDS 100% 5.625 7.875 N Plac1 n/a
2 TRCN0000246606 ATAGCTCTGAGATTCACTATG pLKO_005 521 CDS 100% 10.800 8.640 N Plac1 n/a
3 TRCN0000192248 CGACTCCGAAGAATGATACTT pLKO.1 656 CDS 100% 5.625 4.500 N Plac1 n/a
4 TRCN0000246607 CAAGGGCTCATCAACGAAATA pLKO_005 546 CDS 100% 13.200 9.240 N Plac1 n/a
5 TRCN0000246603 ACCCACATTTCTACCAGTTTC pLKO_005 440 CDS 100% 10.800 7.560 N Plac1 n/a
6 TRCN0000246605 TAGTCATCTGACTGTGCAAAT pLKO_005 805 3UTR 100% 10.800 7.560 N Plac1 n/a
7 TRCN0000246604 TGTGCTGTGCTCGACAGATTG pLKO_005 321 CDS 100% 10.800 7.560 N Plac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019538.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.