Transcript: Mouse NM_019564.3

Mus musculus HtrA serine peptidase 1 (Htra1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Htra1 (56213)
Length:
2051
CDS:
70..1512

Additional Resources:

NCBI RefSeq record:
NM_019564.3
NBCI Gene record:
Htra1 (56213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031484 GCGTCATAAGTACAACTTTAT pLKO.1 564 CDS 100% 13.200 18.480 N Htra1 n/a
2 TRCN0000031486 CCTTCGCAATTCCATCCGATA pLKO.1 1124 CDS 100% 4.050 5.670 N Htra1 n/a
3 TRCN0000031485 CGCTATCATCAATTATGGAAA pLKO.1 1029 CDS 100% 4.950 3.465 N Htra1 n/a
4 TRCN0000031488 GCAATGAAGACATTGTGATTA pLKO.1 1463 CDS 100% 1.320 0.924 N Htra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.