Transcript: Human NM_019594.3

Homo sapiens leucine rich repeat containing 8 VRAC subunit A (LRRC8A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
LRRC8A (56262)
Length:
4368
CDS:
255..2687

Additional Resources:

NCBI RefSeq record:
NM_019594.3
NBCI Gene record:
LRRC8A (56262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129181 CATCAAGTTCACCGACATCAA pLKO.1 1751 CDS 100% 4.950 6.930 N LRRC8A n/a
2 TRCN0000118624 GCTGTGGATCTATAGCCTGAA pLKO.1 1781 CDS 100% 4.050 5.670 N LRRC8A n/a
3 TRCN0000118622 GCTGCACCTCATTGACCAATA pLKO.1 1379 CDS 100% 10.800 7.560 N LRRC8A n/a
4 TRCN0000127689 GCTGCACCTCATTGACCAATA pLKO.1 1379 CDS 100% 10.800 7.560 N LRRC8A n/a
5 TRCN0000118626 CATCTGCTACACCGTCTACTA pLKO.1 1088 CDS 100% 4.950 3.465 N LRRC8A n/a
6 TRCN0000118623 CCGCAACAAGATCGAGAAGAT pLKO.1 2264 CDS 100% 4.950 3.465 N LRRC8A n/a
7 TRCN0000128118 CCGCAACAAGATCGAGAAGAT pLKO.1 2264 CDS 100% 4.950 3.465 N LRRC8A n/a
8 TRCN0000127522 CGCAACAAGATCGAGAAGATC pLKO.1 2265 CDS 100% 4.950 3.465 N LRRC8A n/a
9 TRCN0000118625 GCAGAAGCTGTCCATCAACAA pLKO.1 1961 CDS 100% 4.950 3.465 N LRRC8A n/a
10 TRCN0000127691 GCAGAAGCTGTCCATCAACAA pLKO.1 1961 CDS 100% 4.950 3.465 N LRRC8A n/a
11 TRCN0000130750 GCACAACATCAAGTTCGACGT pLKO.1 1112 CDS 100% 2.160 1.512 N LRRC8A n/a
12 TRCN0000127644 CAAGAACGACTTCGCCTTCAT pLKO.1 1358 CDS 100% 4.950 2.970 N LRRC8A n/a
13 TRCN0000127690 GCTCAAGAGCAACCTAAGCAA pLKO.1 1904 CDS 100% 3.000 1.800 N LRRC8A n/a
14 TRCN0000250779 ACAACCGCTACATCGTCATTG pLKO_005 1846 CDS 100% 10.800 7.560 N Lrrc8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.