Transcript: Mouse NM_019645.3

Mus musculus plakophilin 1 (Pkp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pkp1 (18772)
Length:
4670
CDS:
196..2382

Additional Resources:

NCBI RefSeq record:
NM_019645.3
NBCI Gene record:
Pkp1 (18772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435154 CCAACCGAGGTTCCATGTATG pLKO_005 389 CDS 100% 10.800 15.120 N Pkp1 n/a
2 TRCN0000419334 GGAACTACTCTGGGCTCATTG pLKO_005 1469 CDS 100% 10.800 15.120 N Pkp1 n/a
3 TRCN0000123347 CAATGGTATGAGTCAGTTAAT pLKO.1 1884 CDS 100% 13.200 10.560 N Pkp1 n/a
4 TRCN0000427487 GGCTTACATCTGATGTCAATA pLKO_005 2625 3UTR 100% 13.200 10.560 N Pkp1 n/a
5 TRCN0000123345 CGATAGGAATATGATGGGAAA pLKO.1 2316 CDS 100% 4.050 3.240 N Pkp1 n/a
6 TRCN0000123346 GCAAGTGATGATGACCGTCAA pLKO.1 324 CDS 100% 4.050 3.240 N Pkp1 n/a
7 TRCN0000123344 GCCTCCTAGTTCCATATCTAA pLKO.1 4420 3UTR 100% 5.625 3.938 N Pkp1 n/a
8 TRCN0000123348 GCCGCCTATCTCCTGCAACAA pLKO.1 843 CDS 100% 1.650 1.155 N Pkp1 n/a
9 TRCN0000118864 GACATCTGCTTCATGCAGAAA pLKO.1 625 CDS 100% 0.495 0.347 N PKP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.